[BioC] BLAST - annotate package?

[James W. MacDonald]

Hi Tim,

My bad. I didn't read your email carefully. I don't know if there is 
anything within BioC for this - you might just need to use BLAST directly.

Best,

Jim



On 8/31/2012 3:47 PM, Tim Smith wrote:
> Hi Jim,
>
> Thanks for the reply. I can get it to work even with the 2 without the 
> quotes. But how do I get the values that I want (E-value, mismatches 
> etc.) from the object returned by blastSequences?
>
> many thanks!
>
> ------------------------------------------------------------------------
> *From:* James W. MacDonald <jmacdon at uw.edu>
> *To:* Tim Smith <tim_smith_666 at yahoo.com>
> *Cc:* bioc <bioconductor at stat.math.ethz.ch>
> *Sent:* Friday, August 31, 2012 3:09 PM
> *Subject:* Re: [BioC] BLAST - annotate package?
>
> Hi Tim,
>
> Try changing the hitListSize to character:
>
> > blastSequences(x =
> "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize="2")
> [[1]]
> DNAMultipleAlignment with 2 rows and 36 columns
>       aln
> [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT
> [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT
>
> [[2]]
> DNAMultipleAlignment with 2 rows and 36 columns
>       aln
> [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT
> [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT
>
>
> Best,
>
> Jim
>
>
>
> On 8/31/2012 2:44 PM, Tim Smith wrote:
> > Hi,
> >
> > Sorry for this basic question - I'm new to BLAST!
> >
> > I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a 
> sequence with the rhesus organism. I would like to get the following 
> values:
> >
> > 1. Score (bits)
> > 2. E-value
> > 3. # Matches
> >
> >
> > I am trying to use the 'annotate' package with the following code:
> >
> > library(annotate)
> > xx<- blastSequences(x = 
> "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn")
> >
> >
> > Can (how?) I get the values that I want from the object returned? If 
> not, which package/function should I be using? Also, is there a 
> website where I can get the abbreviations for the databases (e.g. is 
> rhesus = 'rh'?)?
> >
> > Any pointers in the right direction would be highly appreciated
> >
> >
> > many thanks
> >     [[alternative HTML version deleted]]
> >
> > _______________________________________________
> > Bioconductor mailing list
> > Bioconductor at r-project.org <mailto:Bioconductor at r-project.org>
> > https://stat.ethz.ch/mailman/listinfo/bioconductor
> > Search the archives: 
> http://news.gmane.org/gmane.science.biology.informatics.conductor
>
> -- 
> James W. MacDonald, M.S.
> Biostatistician
> University of Washington
> Environmental and Occupational Health Sciences
> 4225 Roosevelt Way NE, # 100
> Seattle WA 98105-6099
>
>
>

-- 
James W. MacDonald, M.S.
Biostatistician
University of Washington
Environmental and Occupational Health Sciences
4225 Roosevelt Way NE, # 100
Seattle WA 98105-6099