[BioC] altcdfenvs

[Laurent Gautier]

Hee Siew Wan wrote:
> Dear All
>  
> I was trying to use a trial data (Dilution) to create a new cdf using "altcdfenvs". Instead of using "matchprobes", I created the "m":

...let's see how 'the "m"' was made then...

> ind <- c(seq(1,199084,by=11), seq(1,199084,by=10), seq(1,199084,by=9),
>  seq(1,199084,by=8), seq(1,199084,by=7), seq(1,199084,by=6))
>  
> m.dil <- new.env()
> m.dil$match <- list(ind[1])
> m.dil$match <- c(m.dil$match, ind[2:length(ind)])
> m.dil <- as.list(m.dil)
> length(m.dil$match)    # [1] 146637
>  
> id.dil <- hgu95av2probe$Probe.Set.Name[ind]
>  
> dil.cdf <- buildCdfEnv.matchprobes(m.dil, id.dil, nrow.chip=640, ncol.chip=640, 
>  chiptype="HG-U95Av2", probes.pack="hgu95av2probe")
>  
> new.dil <- Dilution[,1:2]
> validAffyBatch(new.dil, dil.cdf)    # [1] TRUE
> new.dil.cdfenv <- dil.cdf at envir <mailto:dil.cdf at envir> 
> new.dil at cdfName <mailto:new.dil at cdfName>  <- "new.dil.cdfenv"
>  
> 
>>new.dil
> 
> AffyBatch object
> size of arrays=640x640 features (6405 kb)
> cdf=new.dil.cdfenv (12453 affyids)
> number of samples=2
> number of genes=12453
> annotation=hgu95av2
> 
> 
>>length(pm(new.dil[,1]))
> 
> [1] 12453
>  
> As noted above, I have 12453 probe sets with my new cdf but I also have 12453 probe pairs when in fact I want 146637 probe pairs. The new cdf only returns 1 probe pair per set. Is there a way where I can have the 146637 probe pairs?

...then you may want to actually provide enough _identifiers_ (i.e., 
unique strings) to achieve this. On my side, having made the variable 
'id.dil' the way you did, I have:
 > length(unique(id.dil))
[1] 12453

(I did not anticipate this could be a 'gotcha'; a warning will be added 
to 'buildCdfEnv.matchprobes')


> I tried doing the same thing for ath1121501 array. For this case, I created a data.frame from "ath1121501probe" with the following columns:
> 
>>names(newath)
> 
> [1] "sequence" "probe" "X" "Y" "position"
>  
> However, when I run
>  
> m <- matchprobes(newath$sequence, ath1121501probe$sequence)
>  
> I found out that for some sequences, I have more than 1 match. For example, 
>  
> 
>>ath1121501probe$sequence[16023]
> 
> [1] "GAGTATGCAGTCGAGTGGTGTGATG"
> 
>>ath1121501probe$sequence[16012]
> 
> [1] "GAGTATGCAGTCGAGTGGTGTGATG"
>  
> Hence, the probe that I'm interested in may not be matched to the correct one.


...I am not certain to follow completely what you mean...


> The versions I'm using:
> R: 1.9.0
> altcdfenvs: 1.0.0
> affy: 1.4.31
> ath1121501probe: 1.01

You may want to upgrade to a more recent version of R and of the packages.



Hoping it helps,


L.


> on Windows XP Professional Version 2002.
>  
> Did I do something wrong along the way for both methods? I'd appreciate any help or advice regarding how to get the selected probe pairs for analysis. Also, how do I cite the package "altcdfenvs"? Thank you.
>  
> Regards
> Hee, Siew Wan
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
>