[BioC] question about using matchPattern in the Biostrings package

[Robert Gentleman]

Hi Xiao,
   Right now the code seems not to do quite what you want, it allows for  
insertions, substitutions and deletions, where if I understand you are  
only interested in substitutions. I will see about modifying it so that  
you can specify each of these parameters directly - that is the number  
of insertions, deletions and substitutions, rather than the current  
"global" setting. But that will take a few days, and will surely miss  
the release.

   Best wishes
      Robert

On May 13, 2005, at 9:47 PM, Xiao Shi wrote:

> Hi everybody,
> I have a question about using the matchDNAPattern in the Biostrings  
> package.
> I have a DNA string,eg a=DNAString("AGCTGACTCAGTGGCTTGCT"),and i want  
> to
> find a pattern,eg p="AGCT" with one mismatch.So i use :
>> matchDNAPattern("AGCT",a,mismatch=1)
> Object of class BioString with
> Pattern alphabet: -TGCANBDHKMRSVWY
> Values:
> [1] AGC
> [2] AGCT
> [3] GCTG
> [4] GACT
> [5] CAGT
> [6] GGCT
> [7] TGCT
> But i just want those subsequence who's base order is coherent to the  
> search
> pattern.eg,AGCT is a perfect match;GGCT,CGCT,TGCT with one mismatch;and
> AGC,GCTG,CAGT are also in the result list,but the position of base are
> changed compared to the search pattern,i don't want them.
> How can i achieve this goal?
>
> 	[[alternative HTML version deleted]]
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
>
>
+----------------------------------------------------------------------- 
----------------+
| Robert Gentleman              phone: (206) 667-7700                    
          |
| Head, Program in Computational Biology   fax:  (206) 667-1319   |
| Division of Public Health Sciences       office: M2-B865               
       |
| Fred Hutchinson Cancer Research Center                                 
          |
| email: rgentlem at fhcrc.org                                              
                          |
+----------------------------------------------------------------------- 
----------------+