[BioC] gcrma error? - linked to makeProbePackage ?

[Cei Abreu-Goodger]

Might I suggest, as a temporal solution, that you use the packages that 
I've previously built and posted on the bioC mailing list?

http://article.gmane.org/gmane.science.biology.informatics.conductor/13659

Cheers,

Cei

Benoit Ballester wrote:
> James W. MacDonald wrote:
>   
>> Hi Ben,
>>
>> Benoit Ballester wrote:
>>     
>>> Hi,
>>>
>>> I am trying to use gcrma for the mouse GNF/Novartis data.
>>> This dataset use a custom affy chip gnGNF1Musa. I got the CDF file and 
>>> probe file from GEO.
>>>
>>>
>>>  > library("gngnf1musacdf")
>>>  > library("gngnf1musaprobe")
>>>  > eset.gcrma<-gcrma(Data)
>>> Adjusting for optical effect.......[more dots].....Done.
>>> Computing affinitiesError: length(prlen) == 1 is not TRUE
>>>       
>> This indicates that you have probes of more than one length (e.g., they 
>> are not all 25-mers). This might have to do with what you note below, 
>> that there is an extra column in your probe_tab file. However, there is 
>> error checking in makeProbePackage that is supposed to catch these sorts 
>> of things, so I am wondering how you were ever able to make the package 
>> in the first place.
>>
>> What do you get from
>>
>> head(as.data.frame(gngnf1musaprobe))
>>
>> Does the probe sequence column actually contain probe sequences? If not, 
>> you will need to remove the extra column from your probe_tab file and 
>> re-run makeProbePackage.
>>     
>
> Hi,
>
> This is what I have done - I have *removed* the extra column to have a 
> tab file which looks like that :
>
> AFFX-BioB-5_at 429 502 123 TCGTCAGGTGCAGGTCAGCACGTTG Antisense
> AFFX-BioB-5_at 430 502 132 GCAGGTCAGCACGTTGCTGTCGATT Antisense
> AFFX-BioB-5_at 431 502 138 CAGCACGTTGCTGTCGATTAAGACC Antisense
> AFFX-BioB-5_at 432 502 147 GCTGTCGATTAAGACCGGAGCTTGT Antisense
> AFFX-BioB-5_at 433 502 165 AGCTTGTCCGGAAGATTGCAAATAC Antisense
> AFFX-BioB-5_at 434 502 177 AGATTGCAAATACTGCCCGCAAACG Antisense
> AFFX-BioB-5_at 435 502 183 CAAATACTGCCCGCAAACGTCGCGC Antisense
> AFFX-BioB-5_at 436 502 246 TGAACAGGTGCTGGAGTCGGCGCGC Antisense
>
> exactly like in the HG-U95Av2_probe_tab file that is in 
> matrchprobes/extdata/
>
>
>
> I rerun the makeProbePackage again
>  >  library(matchprobes)
>  >  filename<-system.file("extdata","gnGNF1Musa.probe.6tab")
>  >
>  >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>  >  species<-"Mus_musculus"
>  >
>  >  makeProbePackage("gnGNF1Musa", datafile = filename, maintainer = me, 
> species = species, version = "0.0.1",force = TRUE)
> Importing the data.
> Creating package in ./gngnf1musaprobe
> Existing ./gngnf1musaprobe was removed.
> Writing the data.
> Checking the package.
> Building the package.
> [1] "gngnf1musaprobe"
> Warning message:
> file("") only supports open = "w+" and open = "w+b": using the former
>
>
>
> Then I reinstall gngnf1musaprobe:
>
> benoit at xxxx > R CMD INSTALL gngnf1musaprobe
> * Installing *source* package 'gngnf1musaprobe' ...
> ** R
> ** data
> ** help
>   >>> Building/Updating help pages for package 'gngnf1musaprobe'
>       Formats: text html latex example
>    gngnf1musaprobe                   text    html    latex   example
> ** building package indices ...
> * DONE (gngnf1musaprobe)
>
>
>
> If I look at :
>
>  > library(gngnf1musaprobe)
>  > head(as.data.frame(gngnf1musaprobe))
> [1] sequence                     x
> [3] y                            Probe.Set.Name
> [5] Probe.Interrogation.Position Target.Strandedness
> <0 rows> (or 0-length row.names)
>
>  > gngnf1musaprobe
> Object of class probetable data.frame with 0 rows and 6 columns
>  > gngnf1musaprobe[1,1]
> [1] NA
>
>
> So I still get nothing.
> Am I doing something silly when I create gngnf1musaprobe or there 
> something wrong in the code ?
>
>
> I have tried with the HG-U95Av2_probe_tab file from matchprobes/extdata, 
> and recreated the probe env
>
>  >  library(matchprobes)
>  >  filename<-system.file("extdata"," HG-U95Av2_probe_tab")
>  >
>  >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>  >  species<-"Homo_sapiens"
>  >  makeProbePackage("HG-U95Av2", datafile = filename, maintainer = me, 
> species = species, version = "0.0.1",force = TRUE)
> Importing the data.
> Creating package in ./hgu95av2probe
> Writing the data.
> Checking the package.
> Building the package.
> [1] "hgu95av2probe"
> Warning message:
> file("") only supports open = "w+" and open = "w+b": using the former
>
>
> then :
>   R CMD INSTALL hgu95av2probe
>
> back in R
>  > library(hgu95av2probe)
>  > hgu95av2probe
> Object of class probetable data.frame with 0 rows and 6 columns.
>  > hgu95av2probe[1,1]
> [1] NA
>
>
> Wtill nothing with the examples. Looks like my file is not the problem, 
> and the problem is somewhere else.
> Any ideas ?
>
>
> Cheers,
>
> Ben
>
>   



-- 
The Wellcome Trust Sanger Institute is operated by Genome Research 
Limited, a charity registered in England with number 1021457 and a 
company registered in England with number 2742969, whose registered 
office is 215 Euston Road, London, NW1 2BE.