[BioC] BMP4 probe '1940386' missing in illuminaHumanv2BeadID.db (as compared to illuminaHumanv2ProbeID.db)

Mark Dunning Mark.Dunning at cancer.org.uk
Mon Nov 3 20:07:41 CET 2008


Hi all,

I have taken over the building of these annotation packages and am using
the same text files that Lynn linked to. In the source file, all three
probe IDs (1940386, 3360703,  1850561) have "good" annotation by our
criteria so I am quite puzzled by one probe is missing.

My script for creating the annotation packages doesn't do much more than
taking the refseq identifiers from the source file and passing to the
function makeHUMANCHIP_DB within AnnotationDBI. It's not immediately
obvious where the problem occurs, but I will look into it. I can share
the script if required.

Regards,

Mark



On Mon, 2008-11-03 at 10:41 -0800, Lynn Amon wrote:
> Julian,
> I no longer maintain the Illumina annotation packages but I can tell you
> that I made the illuminaHumanv2ProbeID.db package using annotation
> provided by Nuno Barbosa-Morais who BLASTed the probe sequences against
> hg18.  I only used probes which had 100% similarity with refseq
> sequences.  You can find the BLAST results at:
> http://www.compbio.group.cam.ac.uk/Resources/Annotation/
> 
> >From what I can see by BLASTing the three probe sequences again against
> the current build, all three have perfect matches with refseq sequences
> for BMP4
> 1940386    AGTAGAGGGATGTGGGTGCCGCTGAGATCAGGCAGTCCTTGAGGATAGAC  
> NM_130851.2, NM_138050.2, NM_001202.3
> 3360703    GAGACGCAGACGCAGAGGTCGAGCGCAGGCCGAAAGCTGTTCACCGTTTT  NM_130851.2
> 1850561    ACGCCGCTGCTGCTCCGGCTGAGTATCTAGCTTGTCTCCCCGATGGGATT   NM_001202.3
> 
> Also, all three probes are listed with in the last available
> Illumina-provided annotation file that I can find: 
> HumanWG-6_V2_0_R2_11223189_A
> 1940386    NM_130851.1
> 3360703    NM_130851.1
> 1850561    NM_001202.2
> 
> So, I'm a little confused as to why 1940386 is not showing BMP4 as the
> symbol name in the new annotation package.  What are the other
> annotation results for this probe?  RefSeq? Accession?
> 
> Marc, do you know what annotation file was used for these packages?
> 
> Lynn Amon
> 
> 
> 
> Marc Carlson wrote:
> > Hi Julian,
> >
> > We are not responsible for the mappings used to tie the illumina IDs
> > onto the gene IDs, for those you probably need to talk to the
> > manufacturers.  When we build a new package, all we do is connect those
> > manufacturer provided mappings to the data from public repositories.  If
> > the manufacturer changes their mind about how one of those probes should
> > map we have little choice but to believe them.  But without even seeing
> > these new manufacturer mappings, I would guess that there is probably
> > nothing wrong with this package.  It is (unfortunately) fairly common
> > for manufacturers of microarrays to decide that a probe does not really
> > measure what they originally thought it measured.  This is part of why
> > we rebuild all these packages every six months.  We are trying our best
> > to give you the most current/accurate picture possible. 
> >
> > If you have doubts about the correct mapping of that probe, then please
> > check with the manufacturer to see what they claim their platform
> > measures.  If there are any discrepancies in the package from this, then
> > please let me know immediately.
> >
> >
> >   Marc
> >
> >
> >
> >
> > Julian Lee wrote:
> >   
> >> Hi,
> >>
> >> may i know the differences between the 2 packages and why is this so. I have a gene of interest on the Illumina platform and have been using the IlluminaHumanv2ProbeID.db package to annotate it, but things have changed when i moved to R.2.8.0 on illuminaHumanv2BeadID.db package.
> >>
> >> I'll illustrate it by an example
> >>
> >> Gene of interest - BMP4
> >>
> >> R.2.7.1
> >> illuminaHumanv2ProbeID.db package
> >>
> >>   
> >>     
> >>> bmp4_p<-as.character(unlist(mget('BMP4',revmap(illuminaHumanv2ProbeIDSYMBOL))))
> >>> bmp4_p
> >>>     
> >>>       
> >> [1] "1850561" "1940386" "3360703"
> >>
> >>   
> >>     
> >>> sessionInfo()
> >>>     
> >>>       
> >> R version 2.7.1 (2008-06-23) 
> >> i386-pc-mingw32 
> >>
> >> locale:
> >> LC_COLLATE=English_United States.1252;LC_CTYPE=English_United States.1252;LC_MONETARY=English_United States.1252;LC_NUMERIC=C;LC_TIME=English_United States.1252
> >>
> >> attached base packages:
> >> [1] tools     stats     graphics  grDevices utils     datasets  methods  
> >> [8] base     
> >>
> >> other attached packages:
> >> [1] illuminaHumanv2ProbeID.db_1.1.1 AnnotationDbi_1.2.2            
> >> [3] RSQLite_0.6-9                   DBI_0.2-4      
> >>
> >> All looks well. However, when i upgraded to R.2.8.0, and installed the illuminaHumanv2BeadID.db package, i encountered these results
> >>
> >> R.2.8.0
> >> illuminaHumanv2BeadID.db package
> >>
> >>   
> >>     
> >>> bmp4_p<-as.character(unlist(mget('BMP4',revmap(illuminaHumanv2BeadIDSYMBOL))))
> >>> bmp4_p
> >>>     
> >>>       
> >> [1] "1850561" "3360703"
> >>
> >>   
> >>     
> >>> sessionInfo()
> >>>     
> >>>       
> >> R version 2.8.0 (2008-10-20) 
> >> i386-pc-mingw32 
> >>
> >> locale:
> >> LC_COLLATE=English_United States.1252;LC_CTYPE=English_United States.1252;LC_MONETARY=English_United States.1252;LC_NUMERIC=C;LC_TIME=English_United States.1252
> >>
> >> attached base packages:
> >> [1] tools     stats     graphics  grDevices utils     datasets  methods  
> >> [8] base     
> >>
> >> other attached packages:
> >> [1] illuminaHumanv2BeadID.db_1.1.2 RSQLite_0.7-1                 
> >> [3] DBI_0.2-4                      AnnotationDbi_1.4.0           
> >> [5] Biobase_2.2.0 
> >>
> >>
> >> The probeID/beadID "1940386" has disappeared. Why is this so? is there a mistake in the illuminaHumanv2BeadID package? 
> >> Is it possible to achieve reproducible results by upgrading to 2.8.0?
> >>
> >> many thanks
> >>
> >> julian
> >>
> >>
> >>
> >>     
> >
> > _______________________________________________
> > Bioconductor mailing list
> > Bioconductor at stat.math.ethz.ch
> > https://stat.ethz.ch/mailman/listinfo/bioconductor
> > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
> >
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor



More information about the Bioconductor mailing list