[BioC] biomaRt - current devel version of biomaRt+RCurl don't work
Patrick Aboyoun
paboyoun at fhcrc.org
Fri May 29 20:09:13 CEST 2009
For those using RCurl on Windows and Mac OS X, I just updated RCurl in
the BioC 2.4 and 2.5 extra repositories. You can now download RCurl
0.97-3 in source, Windows, and Mac OS X 10.5 (Leopard) forms via
biocLite. If you are on a Mac OS X 10.4 (Tiger) machine, I had trouble
building the latest RCurl and so the BioC extra repos is at older
version RCurl 0.95-1. If there is community demand for sorting out the
Mac OS X 10.4 (Tiger) issue, I'll look into finding out what the issue
is on that platform.
Patrick
Florian Hahne wrote:
> Hi Paul,
> the issue is fixed in the latest RCurl which you can install by
> source("http://www.bioconductor.org/biocLite.R")
> biocLite("RCurl")
>
> For some reason this didn't pick up the dependency on bitops on my my
> machine, so to be safe you might want to do
> biocLite(c("bitops", "RCurl"))
>
> Please check if the fixes the problem on your end, if not we need the
> reproducible example Tony was suggesting before.
>
> Florian
>
>
> On 28.05.2009, at 21:56, Paul Leo wrote:
>
>> I (and I assume most) have no problem with the "standard" config below.
>> Worth depreciating ?
>>
>>> sessionInfo()
>> R version 2.9.0 (2009-04-17)
>> x86_64-pc-linux-gnu
>>
>> locale:
>> LC_CTYPE=en_AU.UTF-8;LC_NUMERIC=C;LC_TIME=en_AU.UTF-8;LC_COLLATE=en_AU.UTF-8;LC_MONETARY=C;LC_MESSAGES=en_AU.UTF-8;LC_PAPER=en_AU.UTF-8;LC_NAME=C;LC_ADDRESS=C;LC_TELEPHONE=C;LC_MEASUREMENT=en_AU.UTF-8;LC_IDENTIFICATION=C
>>
>>
>> attached base packages:
>> [1] stats graphics grDevices utils datasets methods base
>>
>> other attached packages:
>> [1] biomaRt_2.0.0
>>
>> loaded via a namespace (and not attached):
>> [1] RCurl_0.94-1 XML_1.95-3
>>>
>>
>>
>> -----Original Message-----
>> From: James Bullard <bullard at berkeley.edu>
>> To: whuber at embl.de
>> Cc: Bioconductor <bioconductor at stat.math.ethz.ch>
>> Subject: Re: [BioC] biomaRt - current devel version of biomaRt+RCurl
>> don't work
>> Date: Thu, 28 May 2009 14:00:04 -0700
>>
>> Hi, I am having problems with biomaRt and based on Wolfgang's post it
>> looks like I shouldn't be (or am I being completely naive?):
>>
>> Thanks, jim
>>
>>> library("biomaRt")
>>> mart = useMart("ensembl")
>>> ensembl = useDataset("hsapiens_gene_ensembl",
>> + mart=mart)
>> Checking attributes ... ok
>> Checking filters ... ok
>>> EGsub = c("1635_at"="25", "39329_at"="87", "40797_at"="102")
>>> utr = getSequence(id=EGsub, seqType="3utr",
>> + mart=ensembl, type="entrezgene")
>> CA ..... I cut out a lot of the sequence ...
>> GTGCCCTGCCTTGCACCTCCGCCTTATTTTCTGC 87
>> V1
>> 1 HTTP/1.1 200 OK
>> 2 Date: Thu, 28 May 2009 20:56:08 GMT
>> 3 Server: Apache/2.2.9 (Debian) mod_perl/2.0.4 Perl/v5.10.0
>> 4 Connection: close
>> 5 Transfer-Encoding: chunked
>> 6 Content-Type: text/plain
>> Error in getBM(c(seqType, type), filters = type, values = id, mart =
>> mart, :
>> The query to the BioMart webservice returned an invalid result: the
>> number of columns in the result table does not equal the number of
>> attributes in the query. Please report this to the mailing list.
>>> sessionInfo()
>> R version 2.9.0 Patched (2009-05-28 r48678)
>> x86_64-unknown-linux-gnu
>>
>> locale:
>> LC_CTYPE
>> =
>> en_US
>> .UTF
>> -8
>> ;LC_NUMERIC
>> =
>> C
>> ;LC_TIME
>> =
>> en_US
>> .UTF
>> -8
>> ;LC_COLLATE
>> =
>> en_US
>> .UTF
>> -8
>> ;LC_MONETARY
>> =
>> C
>> ;LC_MESSAGES
>> =
>> en_US
>> .UTF
>> -8
>> ;LC_PAPER
>> =
>> en_US
>> .UTF
>> -8
>> ;LC_NAME
>> =
>> C
>> ;LC_ADDRESS
>> =C;LC_TELEPHONE=C;LC_MEASUREMENT=en_US.UTF-8;LC_IDENTIFICATION=C
>>
>> attached base packages:
>> [1] stats graphics grDevices utils datasets methods base
>>
>> other attached packages:
>> [1] biomaRt_2.0.0
>>
>> loaded via a namespace (and not attached):
>> [1] RCurl_0.95-1 tools_2.9.0 XML_2.3-0
>>
>>
>> On May 28, 2009, at 5:01 AM, Wolfgang Huber wrote:
>>
>>> Hi
>>>
>>> just to warn all users of the development version of biomaRt, please
>>> wait a few days before updating your RCurl, the current devel
>>> versions of these two packages do not work together. We are sorting
>>> it out.
>>>
>>> An example for the error that is produced, with RCurl_0.97-2 and
>>> biomaRt_2.1.0, is shown below. With a previous version of RCurl, the
>>> problem should not arise.
>>>
>>>
>>> library("biomaRt")
>>> mart = useMart("ensembl")
>>> ensembl = useDataset("hsapiens_gene_ensembl",
>>> mart=mart)
>>> EGsub = c("1635_at"="25", "39329_at"="87", "40797_at"="102")
>>> utr = getSequence(id=EGsub, seqType="3utr",
>>> mart=ensembl, type="entrezgene")
>>>
>>> CAGCAGTCAGGGGTCAGGTGTCAGGCCCGTCGGAGCT... 25
>>> CTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAA... 102
>>> TCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTG... 87
>>> TCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTG... 87
>>> V1
>>> 1 HTTP/1.1 200 OK
>>> 2 Date: Thu, 28 May 2009 11:57:58 GMT
>>> 3 Server: Apache/2.2.9 (Debian) mod_perl/2.0.4 Perl/v5.10.0
>>> 4 Connection: close
>>> 5 Transfer-Encoding: chunked
>>> 6 Content-Type: text/plain
>>>
>>> Errore in getBM(c(seqType, type), filters = type, values = id, mart
>>> = mart, :
>>> The query to the BioMart webservice returned an invalid result: the
>>> number of columns in the result table does not equal the number of
>>> attributes in the query. Please report this to the mailing list.
>>>
>>>
>>>> sessionInfo()
>>> R version 2.10.0 Under development (unstable) (2009-05-28 r48665)
>>> x86_64-unknown-linux-gnu
>>>
>>> locale:
>>> [1] LC_CTYPE=C LC_NUMERIC=C LC_TIME=C
>>> [4] LC_COLLATE=C LC_MONETARY=C LC_MESSAGES=it_IT.UTF-8
>>> [7] LC_PAPER=C LC_NAME=C LC_ADDRESS=C
>>> [10] LC_TELEPHONE=C LC_MEASUREMENT=C
>>> LC_IDENTIFICATION=C
>>>
>>> attached base packages:
>>> [1] stats graphics grDevices datasets utils methods base
>>>
>>> other attached packages:
>>> [1] biomaRt_2.1.0 fortunes_1.3-6
>>>
>>> loaded via a namespace (and not attached):
>>> [1] RCurl_0.97-2 XML_2.3-0
>>>>
>>>
>>>
>>> --
>>>
>>> Best wishes
>>> Wolfgang
>>>
>>> ------------------------------------------------
>>> Wolfgang Huber, EMBL, http://www.ebi.ac.uk/huber
>>>
>>> _______________________________________________
>>> Bioconductor mailing list
>>> Bioconductor at stat.math.ethz.ch
>>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>>> Search the archives:
>>> http://news.gmane.org/gmane.science.biology.informatics.conductor
>>
>> _______________________________________________
>> Bioconductor mailing list
>> Bioconductor at stat.math.ethz.ch
>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>> Search the archives:
>> http://news.gmane.org/gmane.science.biology.informatics.conductor
>>
>> _______________________________________________
>> Bioconductor mailing list
>> Bioconductor at stat.math.ethz.ch
>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>> Search the archives:
>> http://news.gmane.org/gmane.science.biology.informatics.conductor
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor
More information about the Bioconductor
mailing list