[BioC] Calculating probe affinities directly from sequence data - GCRMA

[Steve Pederson]

Hi,

I'm working on some alternative ideas for fitting exon arrays & was 
wondering if there is a way to calculate theoretical probe affinities 
directly from sequence data such as:

 > myseq<-paste(sample(rep(c("A","C","T","G"),10),25),collapse="")
 > myseq
[1] "ACTCACTTCGCTAAAACATTGGCTA"


I can find the spline coefficients using "affinity.spline.coefs", but it 
looks like you can only perform the calculations via

 > compute.affinities.local(myAffyBatch)

Currently, you can't specify exon arrays as an AffyBatch, but the 
sequences for each probe are available in a probe_tab file.


Thanks,

Steve