[BioC] xmapcore get intronic sequence

[Keith Satterley]

Another (non R) site that will provide introns (among other things) 
between specified co-ords is GABOS(Get A Bit Of Sequence) at:

http://bioinf.wehi.edu.au/gabos/

Select genome = hg19,
Select Annotation file as ensGene,
Select chr17.fa from the drop down list of chromosomes,
Enter a sequence range like 7590695-7590863
Click the "Retrieve Sequence Data" button and you will get:

 > hg19 chr17 + ensGene ENST00000431639 Gene 10 [ 1 17429 ] 7589389 
7606817 [ -0 17429 +0 ] 7589389 7606817
 > hg19 chr17 + ensGene ENST00000431639 Intron '1/10 [ 1153 1321 ] 
7590695 7590863 [ -0 169 +0 ] 7590695 7590863
CCAATCCAGGGAAGCGTGTCACCGTCGTGGAAAGCACGCTCCCAGCCCGAACGCAAAGTGTCCCCGGAGCCCAGCAGCTACCTGCTCCCTGGACGGTGGC
TCTAGACTTTTGAGAAGCTCAAAACTTTTAGCGCCAGTCTTGAGCACATGGGAGGGGAAAACCCCAATC

This tells you that there is a Gene with 10 introns in this region and 
that part (169 bases) of the first intron is in the specified sequence 
range.

GABOS uses copies of UCSC chromosome data and UCSC Browser annotation files,

cheers,

Keith

========================
Keith Satterley
Bioinformatics Division
The Walter and Eliza Hall Institute of Medical Research
Parkville, Melbourne,
Victoria, Australia
=======================



Stephen Taylor wrote:
> Hi Tim,
>
>> probeset.to.exon( probesetids, rm.unreliable=F )
>
> Unfortunately this is still not the same size:
>
> > length(probeset.to.exon( probesetids, rm.unreliable=F ))
> [1] 1274
> > length(probesetids)
> [1] 1771
>
> Thanks,
>
> Steve
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: 
> http://news.gmane.org/gmane.science.biology.informatics.conductor

______________________________________________________________________
The information in this email is confidential and intend...{{dropped:4}}