[BioC] Lumi mouse mapping

[Gilbert Feng]

Hi, Antonia

Could you run sessionInfo()? The latest one is 1.10.1 .

Let me know if you have any question.

Best

Gilbert


On 5/18/10 7:10 PM, "Antonina Mitrofanova, PhD" <antonina at c2b2.columbia.edu>
wrote:

> Dear List,
> 
> I am analyzing mouse Illumina data. I am interested in probes mapping to
> Akt1...  Using BeadStudio, I was able to find such a probe (nuID
> 3Xqv.fD8.TUv4hRE7o, sequence
> CCTGGGGTTTTTCTTAATTTATTTCATCCAGTTTGAGACCACACATGTGG)...
> 
> when I run this sequence against BLAST, it is a perfect match to Akt1 ...
> 
> also, in the annotation files (from here
> http://www.compbio.group.cam.ac.uk/Resources/Annotation/), such as  MouseWG-
> 6_V2_0_R0_11278593_A, it is listed as a 100% match to Akt1 (same in the older
> versions of the annotation files)...
> 
> however, when i make a call to getSYMBOL
> ("3Xqv.fD8.TUv4hRE7o", 'lumiMouseAll.db'), the outcome is NA...
> 
> why is this happening?
> 
> thanks a lot!
> Antonina
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor