[BioC] trim adapter with mismatch tolerance

[Harris A. Jaffee]

Please give a read example and exactly what you want to happen and not
happen, and, optionally, exactly you tried and what did happen, along
with the output of sessionInfo() in case that may be relevant.  The spec
and examples in the Biostrings::trimLRPatterns help page are not ideal.

You are correct that a single integer in max.Lmismatch should prevent
matches/trimming by anything but the entire Lpattern.

I can't tell whether you are saying that you need with.Lindels=TRUE or
Lfixed="pattern".

On Dec 18, 2011, at 11:38 PM, Kunbin Qu wrote:

> Hi,
>
> I have some reads with 25 bp adapter at the five prime end. Some of  
> the reads do not have perfect match with the adapter, even with  
> some indels.  I tried to use trimLRPatterns to trim them off, but I  
> got confused with the max.Lmismatch parameter, as it is doing sub- 
> string trimming too. The adapter in my reads are  the full length  
> of 25 bp, without shortening to any substring. How should I specify  
> the parameter then? Or maybe I could use some other functions from  
> ShortRead? Please help. Thanks.
>
> -Kunbin
>
> code I used, but this code cannot accommodate the mismatches.
>
> reads<-readFastq("test.fq")
> adapter<-DNAString("CTGGCCTTTGAGACTGGCCCACCTC")
> seqs<-sread(reads)
> trimCoordsAR<-trimLRPatterns(Lpattern=adapter, subject=seqs,  
> max.Lmismatch =1, ranges=T)
>
> ______________________________________________________________________
> The contents of this electronic message, including any attachments,  
> are intended only for the use of the individual or entity to which  
> they are addressed and may contain confidential information. If you  
> are not the intended recipient, you are hereby notified that any  
> use, dissemination, distribution, or copying of this message or any  
> attachment is strictly prohibited. If you have received this  
> transmission in error, please send an e-mail to  
> postmaster at genomichealth.com and delete this message, along with  
> any attachments, from your computer.
> 	[[alternative HTML version deleted]]
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/ 
> gmane.science.biology.informatics.conductor