[BioC] fasta biostrings bioconductor

[Cook, Malcolm]

Hi 

Just a thought....

Did you run the grep with -i option for case insensitivity?

If you should find a "P" then look again and see if you have any control-As in that file.  

If you do, then, I'm guessing that file came from NCBI.

If it did, then, know this:  NCBI uses control-A to separate multi-line deflines in fasta files.


That's all I got,

Malcolm Cook

 >-----Original Message-----
 >From: bioconductor-bounces at r-project.org [mailto:bioconductor-bounces at r-project.org] On Behalf Of DNAStringSet Error Biostrings
 >in R [guest]
 >Sent: Friday, March 28, 2014 11:43 AM
 >To: bioconductor at r-project.org; ttatanas at ucsd.edu
 >Subject: [BioC] fasta biostrings bioconductor
 >
 >
 >I posted this same quandary on Biostars and stack overflow.
 >
 >I am attempting to import a fasta file of sequences into R using Bioconductor's 'Biostrings' package and the 'DNAStringSet' function but
 >I keep getting the same error:
 >
 >Error in .Call2("new_XString_from_CHARACTER", classname, x, start(solved_SEW),  :
 >key 112 (char 'p') not in lookup table
 >
 >My fasta file ("FileName.fa") is comprised of various length sequences, in the following format:
 >
 >>GeneNameOne
 >CAGACACCCATAGATACAGATAGACAGATAGAGAAGACACCACCACACAATGA
 >>GeneNameTwo
 >CGCGACATGAACCCATGATAGACGATGAGACCCCACACACACC
 >...etc
 >
 >I performed 'grep p FileName.fa' in the Unix terminal, but I received no output.
 >
 >Does anyone have an idea on what is going on?
 >
 >Thanks in advance.
 >
 > -- output of sessionInfo():
 >
 >Error in .Call2("new_XString_from_CHARACTER", classname, x, start(solved_SEW),  :
 >key 112 (char 'p') not in lookup table
 >
 >--
 >Sent via the guest posting facility at bioconductor.org.
 >
 >_______________________________________________
 >Bioconductor mailing list
 >Bioconductor at r-project.org
 >https://stat.ethz.ch/mailman/listinfo/bioconductor
 >Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor