[R] length of a string

[Benilton Carvalho]

As long as you keep in mind Prof. Ripley's comment, you're going to  
be fine with nchar().

http://tolstoy.newcastle.edu.au/R/e2/devel/07/05/3450.html

Remember that what you want exactly is given by nchar(obj,  
type="chars"), which is **NOT** the default on R 2.5.1 (only on  
R-2.6.0).

In your particular situation, assuming R-2.5.1, nchar(obj) works, but  
i'm afraid it's only a coincidence.

b

On Sep 5, 2007, at 11:05 AM, (Ted Harding) wrote:

> On 05-Sep-07 13:50:57, João Fadista wrote:
>> Dear all,
>>
>> I would like to know how can I compute the length of a string in a
>> dataframe. Example:
>>
>> SEQUENCE                               ID
>> TGCTCCCATCTCCACGG            HR04FS000000645
>> ACTGAACTCCCATCTCCAAT      HR00000595847847
>>
>> I would like to know how to compute the length of each SEQUENCE.
>>
>> Best regards,
>> João Fadista
>
>   nchar("ACTGAACTCCCATCTCCAAT")
>   [1] 20
>
> seems to work. Find it, and related functions, with
>
>   help.search("character")
>
> As it happens, help.search("string") will not help!
>
> Best wishes,
> Ted.
>
> --------------------------------------------------------------------
> E-Mail: (Ted Harding) <Ted.Harding at manchester.ac.uk>
> Fax-to-email: +44 (0)870 094 0861
> Date: 05-Sep-07                                       Time: 15:05:22
> ------------------------------ XFMail ------------------------------
>
> ______________________________________________
> R-help at stat.math.ethz.ch mailing list
> https://stat.ethz.ch/mailman/listinfo/r-help
> PLEASE do read the posting guide http://www.R-project.org/posting- 
> guide.html
> and provide commented, minimal, self-contained, reproducible code.