[R] Error in FUN(X[[1L]], ...) : STRING_ELT() can only be applied to a 'character vector', not a 'integer'

[David Winsemius]

On May 23, 2010, at 3:27 AM, Erik Iverson wrote:

> Hello,
>
> sedm1000 wrote:
>> Sorry - I figured that this to be a more common defined error than  
>> anything
>> specific to the data/function...  Thanks for looking at this.
>> The data and function are below. Creating a single line of the  
>> data.frame at
>> a time will work (i.e. fold(s))
>> For multiple line data.frames, an error is generated. Ideally I  
>> would like
>> to record the output from fold(sq) in a two column data.frame,  
>> whether it
>> requires reading in the data to fold one line at a time or in bulk.
>>> library(GeneRfold)
>>> s<- "ATTATGCATCGACTAGCATCACTAG"
>>> fold(s)
>> [[1]]
>> [1] "...((((........))))......"
>> [[2]]
>> [1] -2.3
>>> sq <- data.frame(c("ATGTGTGATATGCATGTACAGCATCGAC",
>> + 		"ACTAGCACTAGCATCAGCTGTAGATAGA",
>> + 		"ACTAGCATCGACATCATCGACATGATAG",
>> + 		"CATCGACTACGACTACGTAGATAGATAG",
>> + 		"ATCAGCACTACGACACATAGATAGAATA"))
>>> fold(sq)

Building on Erik's comments, perhaps trying:

 > sq <- data.frame(s1 = c("ATGTGTGATATGCATGTACAGCATCGAC",
+  		"ACTAGCACTAGCATCAGCTGTAGATAGA",
+  		"ACTAGCATCGACATCATCGACATGATAG",
+  		"CATCGACTACGACTACGTAGATAGATAG",
+  		"ATCAGCACTACGACACATAGATAGAATA"), stringsAsFactors=FALSE)

stringsAsFactors=FALSE leaves the character vector "unfactored".

 > str(sq)
'data.frame':	5 obs. of  1 variable:
  $ s1: chr  "ATGTGTGATATGCATGTACAGCATCGAC"  
"ACTAGCACTAGCATCAGCTGTAGATAGA" "ACTAGCATCGACATCATCGACATGATAG"  
"CATCGACTACGACTACGTAGATAGATAG" ...

Passing sq would still be passing a list. You probably want just the  
first and only column.

 > str(sq$s1)
  chr [1:5] "ATGTGTGATATGCATGTACAGCATCGAC"  
"ACTAGCACTAGCATCAGCTGTAGATAGA" ...

fold(sq$s1)   # passing a character vector, which is what the error  
message says is needed.

-- 
David.

>> Error in fold(sq) :   STRING_ELT() can only be applied to a  
>> 'character vector', not a 'list'
>>> struct <- t(as.data.frame(sapply(sq[,1], fold, t=37)))
>> Error in FUN(X[[1L]], ...) :
>> STRING_ELT() can only be applied to a 'character vector', not a  
>> 'integer'
>
> This appears to be a Bioconductor package, so if this doesn't help,  
> I'd ask on the specific bioconductor mailing list.  I don't have the  
> package installed, so take the following advice with that in mind.
>
> Did you look at the str(sq) ?  It is not a character vector, it is a  
> factor, so you might need to convert or see stringsAsFactors in ? 
> options.
>
> Try
>
> lapply(sq[, 1], function(x) fold(as.character(x)))
>
> If that doesn't work, try the other list.
>
> Good luck,
> Erik
>
> ______________________________________________
> R-help at r-project.org mailing list
> https://stat.ethz.ch/mailman/listinfo/r-help
> PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
> and provide commented, minimal, self-contained, reproducible code.

David Winsemius, MD
West Hartford, CT