[R] How to load fasta file with openPrimeR?

[Luigi Marongiu]

Thank you. it looks like it worked:
```

> fasta.file <- "stx.fa"
> seq.df <- read_templates(fasta.file)
> fasta.file
[1] "stx.fa"
> seq.df
                       ID                  Header   Group Identifier
Sequence_Length Allowed_Start_fw Allowed_End_fw
1 >MW311073.1 Escheric... >MW311073.1 Escheric... default          1
          180                1             30
  Allowed_Start_rev Allowed_End_rev              Allowed_fw
 Allowed_rev Allowed_Start_fw_ali
1               151             180 atgaagaagatgtttatggc...
cgctggaatctgcaaccgtt...                    1
  Allowed_End_fw_ali Allowed_Start_fw_initial Allowed_End_fw_initial
Allowed_Start_fw_initial_ali
1                 30                        1                     30
                         1
  Allowed_End_fw_initial_ali Allowed_Start_rev_ali Allowed_End_rev_ali
Allowed_Start_rev_initial
1                         30                   151                 180
                      151
  Allowed_End_rev_initial Allowed_Start_rev_initial_ali
Allowed_End_rev_initial_ali                Sequence
1                     180                           151
         180 atgaagaagatgtttatggc...
            InputSequence Run
1 atgaagaagatgtttatggc... stx
```
When the original file stx.fa is:
```
>MW311073.1 Escherichia coli strain XP2F shiga toxin 2 (stx2) gene, partial cds
ATGAAGAAGATGTTTATGGCGGTTTTATTTGCATTAGTTTCTGTTAATGCAATGGCGGCGGATTGCGCTA
AAGGTAAAATTGAGTTTTCCAAGTATAATGAGAATGATACATTCACAGTAAAAGTGGCCGGAAAAGAGTA
CTGGACCAGTCGCTGGAATCTGCAACCGTTACTGCAAAGT
```

On Mon, Feb 15, 2021 at 7:28 PM Bill Dunlap <williamwdunlap using gmail.com> wrote:
>
> > but if I give these commands to a local file:
> > ```
> > fasta.file <- system.file("extdata", "IMGT_data", "templates",
> >                 "stx.fa", package = "openPrimeR")
> > fasta.file <- system.file("stx.fa", package = "openPrimeR")
> > ```
> > where stx.fa il the file I wanted to open and that is present in the
> > working directly. I get only an empty object.
>
> If "stx.fa" is in fact in the current working directory then use
>    fasta.file <- "stx.fa"
> system.file() is for accessing files in installed packages.
>
> -Bill
>
> On Mon, Feb 15, 2021 at 10:11 AM Luigi Marongiu
> <marongiu.luigi using gmail.com> wrote:
> >
> > Hello,
> > I am trying to load a fast file with the package 'openPrimeR'. The
> > manual (https://www.bioconductor.org/packages/release/bioc/vignettes/openPrimeR/inst/doc/openPrimeR_vignette.html)
> > says to use:
> > ```
> > fasta.file <- system.file("extdata", "IMGT_data", "templates",
> >                 "Homo_sapiens_IGH_functional_exon.fasta", package =
> > "openPrimeR")
> > # Load the template sequences from 'fasta.file'
> > seq.df.simple <- read_templates(fasta.file)
> > ```
> > but if I give these commands to a local file:
> > ```
> > fasta.file <- system.file("extdata", "IMGT_data", "templates",
> >                 "stx.fa", package = "openPrimeR")
> > fasta.file <- system.file("stx.fa", package = "openPrimeR")
> > ```
> > where stx.fa il the file I wanted to open and that is present in the
> > working directly. I get only an empty object.
> > What am I getting wrong?
> > Thank you
> >
> >
> > --
> > Best regards,
> > Luigi
> >
> > ______________________________________________
> > R-help using r-project.org mailing list -- To UNSUBSCRIBE and more, see
> > https://stat.ethz.ch/mailman/listinfo/r-help
> > PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
> > and provide commented, minimal, self-contained, reproducible code.



-- 
Best regards,
Luigi