[BioC] reverse complement or no reverse complemnt on biomaRt / biomart.org

[James W. MacDonald]

Tefina Paloma wrote:
> James W. MacDonald <jmacdon at ...> writes:
> 
> 
> Hi,
> 
> if I just export the sequence by using the "export data" button on the left hand
> side of the biomart page.

That isn't a very precise description of what you did. If I go to 
biomart.org, then choose GRCh37 as the dataset, then filter on HGNC 
symbol using VEGFC, then go to attributes, click the Sequences radio box 
and then choose Flank (Transcript), and check the Upstream flank box and 
enter 50 in the box to the right, I get the following sequence;

 >ENSG00000150630|ENST00000280193
CCGCCGCCAGCGCCCCCGCCGCAGCGCCCGCGGCCCGGCTCCTCTCACTT


Which is identical to what I get from biomaRt, as well as Ensembl.

In addition, I don't see an 'export data' button on the left hand side 
of the biomart page. Is it possible that you are using something other 
than biomart.org?


> I do not do this ususally, but I just wanted to compare the different
> possibilities of exporting the sequence to make sure that I always get the same
> sequence.
> 
> Best,
> Tefina
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor

-- 
James W. MacDonald, M.S.
Biostatistician
Douglas Lab
University of Michigan
Department of Human Genetics
5912 Buhl
1241 E. Catherine St.
Ann Arbor MI 48109-5618
734-615-7826