[BioC] CRISPRseek: bug, or did I make an error?

Zhu, Lihua (Julie) Julie.Zhu at umassmed.edu
Sun Aug 3 17:07:48 CEST 2014


Mark,

Very nice to see you in Boston! Thanks for coming to the CRISPRseek session
and for giving the great RNA-seq session on Thursday.

I need to remove some of the requirements when users set findgRNA = FALSE.

For now, here is the parameter setting that works.

FYI, there is no restriction enzyme recognition site >=6 nt. I relaxed
minREpatternSize = 4.

library("GenomicFeatures")
txdb <- makeTranscriptDbFromUCSC(
             genome="danRer7",
 tablename="refGene",
 transcript_ids=NULL,
 circ_seqs=DEFAULT_CIRC_SEQS,
 url="http://genome.ucsc.edu/cgi-bin/",
 goldenPath_url="http://hgdownload.cse.ucsc.edu/goldenPath",
 miRBaseBuild=NA)

REpatternFile <- system.file("extdata", "NEBenzymes.fa", 
            package = "CRISPRseek")
library("BSgenome.Drerio.UCSC.danRer7")
library("CRISPRseek")

offTargetAnalysis("pch12.fa", BSgenomeName=Drerio, findgRNAs=FALSE,
outputDir="crispr_X", findPairedgRNAOnly=FALSE,max.mismatch=3, chromToSearch
="all", findgRNAsWithREcutOnly=FALSE, REpatternFile = REpatternFile,
annotateExon=TRUE, txdb = txdb, minREpatternSize = 4)


I will need to remove the requirements to set findPairedgRNAOnly=FALSE,
findgRNAsWithREcutOnly=FALSE when findgRNAs = FALSE.


Please let me know if you encounter additional problems. Thanks!

Best regards,

Julie
________________________________________
From: Mark Robinson [mark.robinson at imls.uzh.ch]
Sent: Friday, August 01, 2014 5:11 PM
To: Zhu, Lihua (Julie)
Subject: bug, or did I make an error?

Hi Julie,

Thanks for the session today.


Here is my FASTA file:

mark at imlspenticton:~/scratch$ more pch12.fa
>pcdh12
CACGCTCACGTAGATCATCCAGG



library("BSgenome.Drerio.UCSC.danRer7")
library("CRISPRseek")


offTargetAnalysis("pch12.fa", BSgenomeName=Drerio, findgRNAs=FALSE,
outputDir="crispr_X", max.mismatch=1, chromToSearch ="chr14", REpatternFile
= REpatternFile, annotateExon=FALSE)


Here is what I ran in R:

> offTargetAnalysis("pch12.fa", BSgenomeName=Drerio, findgRNAs=FALSE,
outputDir="crispr_X", max.mismatch=1, chromToSearch ="chr14", REpatternFile =
REpatternFile, annotateExon=FALSE)
Validating input ...
crispr_X/
exists already. Please type 1 if you want to
            overwrite the outputDir and 2 if you want to exit.
1
>>> Finding all hits in sequences chr14 ...
>>> DONE searching
Building feature vectors for scoring ...
Error in buildFeatureVectorForScoring(hits = hits, canonical.PAM = PAM,  :
  Empty hits!
In addition: Warning message:
In searchHits(gRNAs = gRNAs, PAM = PAM.pattern, BSgenomeName = BSgenomeName,
:
  No matching found, please check your input sequence, and make
            sure you are using the right genome. You can also alter your
            search criteria such as increasing max.mismatch!

Cheers, Mark


------ End of Forwarded Message



More information about the Bioconductor mailing list